Warning: count(): Parameter must be an array or an object that implements Countable in /homepages/19/d650279470/htdocs/app653499953/wp-includes/post-template.php on line 284

Warning: count(): Parameter must be an array or an object that implements Countable in /homepages/19/d650279470/htdocs/app653499953/wp-includes/post-template.php on line 284

Warning: count(): Parameter must be an array or an object that implements Countable in /homepages/19/d650279470/htdocs/app653499953/wp-includes/post-template.php on line 284

Warning: count(): Parameter must be an array or an object that implements Countable in /homepages/19/d650279470/htdocs/app653499953/wp-includes/post-template.php on line 284

«

»

সেপ্টে. 26

প্রোটিনের গাঠনিক জীববিজ্ঞানঃ লেকচার ২- গাঠনিক রসায়ন-প্রাথমিক গঠন

[ পূর্ববর্তী লেকচার | কোর্সের মূল পাতা | নিবন্ধনের লিংক ]

দ্বিতীয় লেকচারে অল্পবিস্তর প্রোটিনের গঠনের রসায়ন নিয়ে হালকা আলোচনা করা হয়েছে। এখানে প্রোটিন কিভাবে তৈরি হয় কোষে, এমিনো এসিড সন্নিবেশন, পেপটাইড বন্ধন গঠন ইত্যাদি বিষয় এসেছে। এই লেকচার থেকে প্রধানত প্রোটিনের প্রাথমিক গঠন

সম্বন্ধে জানতে পারবেন।

সহায়ক বই: Leninger Principles of Biochemistry. [protein structure section]

 

লেকচার ২

 

যারা ইউটিউব ব্যবহার করতে পারছেন না তারা এখান থেকে দেখতে পারেনঃ

লিংক ১

লিংক ২

 

ক) প্রোটিনের প্রাথমিক গঠন বলতে কি বুঝিঃ

প্রোটিনের প্রাথমিক গঠন হল এমিনো এসিড দিয়ে তৈরি হওয়া একটি চেইন। এরকম ২০ ধরনের এমিনো এসিড বিভিন্ন বিন্যাসে মিলে একটা প্রোটিনের প্রাথমিক গঠন তৈরি করে। একটা কোষের একটা প্রোটিনের প্রাথমিক গঠন অন্য রকম আরেকটির চেয়ে ভিন্ন হয়, মানে এমিনো এসিডগুলোর বিন্যাস ভিন্ন হয়। প্রশ্ন আসতে পারে এই এমিনো এসিডগুলো কোথা থেকে আসে। উত্তর হল কিছু এমিনো এসিড একটা জীব নিজের শরীরে বিভিন্ন রাসায়নিক বিক্রিয়ার মাধ্যমে বানাতে পারে আর কিছু পারেনা। যেমন, মানুষের জন্য ৯ টি এমিনো এসিড প্রয়োজনীয় (essential amino acid)। তার মানে এই নয় যে অন্য গুলা লাগবেনা। এই কথাটার মানে হল ২০ টি এমিনো এসিডই লাগবে কিন্তু মানুষ এই ৯টি এমিনো এসিড নিজের শরীরে তৈরি করতে পারেনা। তাই বাইরে থেকে খাবারের মাধ্যমে গ্রহন করতে হয়।

 

 

খ) কোথা থেকে এমিনো এসিডের বিন্যাস তৈরি হয়ঃ

এমিনো এসিডের বিন্যাস নির্ভর করে ডিএনএ তে নিউক্লিওটাইডের বিন্যাস (যেটাকে বেইজ বলে, চার ধরনের বেইজ আছেঃ ATGC) সংকেতের উপর। একটা প্রোটিনের বিন্যাস কোড ডিএনএ তে যে অংশে বেইজ দিয়ে সাজানো থাকে তাকে জিন বলে। উদাহরণস্বরূপ, জিন এর বিন্যাসকে এভাবে বেইজ দিয়ে লেখা যায়ঃ

ATGATTGGGCCATAAGCTATCATA….

ডিএনএ থেকে মেসেন্জ্ঞার আরএনএ বা এমআরএনএ (mRNA) তৈরি হয় জিনের সংকেত কপি করে। এই প্রক্রিয়াকে বলে ট্রান্সক্রিপশান। তবে mRNA তে ‘T’ এর যায়গায় যুক্ত হয় অন্যধরনের বেইজ ‘U’। সেজন্য mRNA তে যে চারটি বেইজ থাকে তারা হলঃ AUGC। উদাহরণস্বরূপ,  উপরের জিনটিকে mRNA বিন্যাস হিসেবে এভাবে বেইজ দিয়ে লেখা যায়ঃ

AUGAUUGGGCCAUAAGCUAUCAUA….

এরকম তিনটি বেইজ মিলে একটা এমিনো এসিড যুক্ত হওয়ার সংকেত তৈরি করে। এই তিনটা বেইজের সংকেত কে বলে কোডন। যেমনঃ AUG কোডন যদি কোন mRNA তে থাকে (এই সংকেত সব mRNA তে থাকে, এটাকে বল স্টার্ট কোডন। মানে এখান থেকে প্রোটিনের চেইন তৈরি শুরু হয়) তবে মেথায়োনিন নামে একটা এমিনো এসিড, চেইনের সাথে যুক্ত হবে। যে প্রক্রিয়ার মাধ্যমে এটা ঘটে তাকে বলে ট্রান্সলেশান। ট্রান্সক্রিপশান এবং ট্রান্সলেশানের বিশদ আলোচনায় এখানে যাচ্ছি না।  লেকচার ভিডিওটি তে এটা নিয়ে একখানা ক্লিপ দেয়া আছে। নিচের ছবিটায় (এবং লিংক এ) সংক্ষেপে দেখে নিতে পারেন কিভাবে mRNA এর সংকেতের উপর ভিত্তি করে tRNA একেকটা বিভিন্ন এমিনো এসিড নিয়ে এসে একটার পর একটি বিন্যস্ত করছে পলিপেপটাইড চেইন এ।

 

এখন ধরি একটা জিনে ৯০০ টি বেইজ আছে, তাহলে তিনটি করে কোডন কোড করবে ৩০০টি এমিনো এসিড। তার মানে এই জিন থেকে যে প্রোটিনটি তৈরি হবে তার দৈর্ঘ্য হবে ৩০০ এমিনো এসিড, অথর্াৎ প্রোটিনটি ৩০০ এমিনো এসিডের চেইন বা প্রাথমিক গঠন। সাধারনভাবে মনে রাখা দরকার প্রতিটি mRNA এর দৈর্ঘ্য হচ্ছে ৩ এর গুণিতক। প্রতিটি জিন শুরু হয় স্টার্ট কোডন দিয়ে এবং শেষ হয় স্টপ কোডন দিয়ে। স্টার্ট কোডন একটিঃ AUG এবং স্টপ কোডন তিনটি UAA, UGA, UAG। আরেকটু স্পষ্ট করে বলতে গেলে, প্রতিটা mRNA বিন্যাস শুরু হবে AUG দিয়ে এবং শেষ হবে UAA, UGA, UAG তিনটার যেকোন একটি দিয়ে।

নিচের চার্টটিতে কোন এমিনো এসিডের কোডন কিকি দেখে নিন চট করে আর নিচের অ্যাসাইনমেন্ট টি করে ফেলুন।

 

সাহায্যঃ কিভাবে কোডন চার্ট দেখবেন?  প্রতিটা কোডন তিনভাগে ভাগ করা। প্রথম, দ্বিতীয় এবং তৃতীয় পসিশান কোনটা হবে উল্লেখ করা আছে। তাহলে ACG কোডন কোন এমিনো এসিড কোড করবে কিভাবে বের করব? প্রথম সারির A নিলাম, দ্বিতীয় সারির (৪টি কলাম) C কলাম বেছে নিলাম এবং তৃতীয় সারি থেকে তৃতীয় পসিশন G। তাহলে এমিনো এসিড দাঁড়ালোঃ থ্রিয়োনিন (thr)। মনো রাখা দরকার একই এমিনো এসিডের জন্য একাধিক কোডন আছে। যেমন তিনটি করে বেইজ মিলিয়ে AUGC এর কম্বিনেশান পারমুটেশান করলে কোডন সংখ্যা দাঁড়ায় ৬৪। কিন্তু এমিনো এসিড আছে ২০ টি। তার মানে নিশ্চিতভাবেই একটি এমিনো এসিডের জন্য একধিক কোডন আছে। এই ঘটনা কে বলে কোডন ডিজেনারেসি (degeneracy of codons)। তবে উপরে উল্লেখ করেছি তিনটি কোডন হচ্ছে স্টপ কোডন, মানে এগুলো দিয়ে কোন এমিনো এসিড কোড হয়না। তারমানে ৬১ টি কোডন ২০ টি এমিনো এসিড কোড করে।

অ্যাসাইনমেন্টঃ

এই ডিএনএ সংকেত থেকে এতে কয়টি কোডন আছে, এর mRNA বিন্যাস এবং পেপটাইডটির প্রাথমিক গঠন বের করে ফেলুন দেখি। mRNA বিন্যাস লিখতে পারেন  AUGGUCCGAUGCAGU  এভাবে। প্রাথমিক গঠন এভাবে লিখতে পারেনঃ Met-Thr-Ala- ইত্যাদি। এগুলো হল এমিনো এসিডের তিন অক্ষর শর্ট ফর্ম। উপরে উল্লেখিত চার্টে পাবেন।

DNA বিন্যাসঃ

ATGCGAGCGCCGGAATTCGTATGCTAA

 

গ) এমিনো এসিডের গঠনঃ

উপরে একটি এমিনো এসিডের বেসিক মডেলের ছবি দেয়া হল। এই রাসায়নিক গঠনে যেসব জিনিস ট্যাগ করা আছে লক্ষ্য করুন। বাম পাশে ‘এমিনো গ্রুপ’, ডান পাশে ‘কার্বক্সিল গ্রুপ’, মাঝখানে ‘আলফা কার্বন’, উপরে ‘হাইড্রোজেন’ এবং নিচে ‘ভ্যারিয়েবল গ্রুপ বা সাইড চেইন’। প্রথম চারটা অংশ প্রত্যেক এমিনো এসিডের থাকে। শুধু যে জিনিসে একটা এমিনো এসিড আরেকটার চেয়ে ভিন্ন হয়ে সেটা হল ভ্যারিয়েবল গ্রুপ বা সাইড চেইন। এবার এই ছবিটি দেখুনঃ

 

দেখুনতো ঠিকঠাক আছে কিনা? খেয়াল করুন, সাইড চেইনের উপর ভিত্তি করে এমিনো এসিড গুলোকে বিভিন্ন ভাগে ভাগ করা হয়েছে। এগুলোর আচরণ নিয়ে আমরা পরে আলোচনা করব একটু বিস্তারিত। তবে তিনটা ভাগ মনে রাখুন। নন-পোলার (যাদের সাইড চেইন এ কোন চার্জ নাই), পোলার (যাদের সাইড চেইনে চার্জের ভারসাম্যহীনতা আছে, একপাশে অন্য পাশের চেয়ে বেশি বা কম) এবং চার্জড (যাদের সাইড চেইনে আসলেই চার্জ আছে)।

 

ঘ) পেপটাইড বন্ধনঃ

একটি এমিনো এসিড আরেকটির সঙ্গে যেই বন্ধনে একটি চেইনে যুক্ত হয় সেটাকে বলে পেপটাইড বন্ধন। এটি একটি কোভ্যালেন্ট বন্ধনী, মানে ইলেক্ট্রন শেয়ারের মাধ্যমে এই বন্ধন হয়।

এই ছবিটি লক্ষ্য করুন।

এখানে একটি এমিনো এসিডে এমিনো গ্রুপের নাইট্রোজেনের সঙ্গে আরেকটি এমিনো এসিডের কার্বক্সিল গ্রুপের কার্বন কোভ্যালেন্ট বন্ধনে যুক্ত হয়ে একটি ডাইপেপটাইড এবং একটি পানির অণু তৈরি করেছে। এভাবে অনেকগুলি এমিনো এসিড যুক্ত হয়ে একটা পলিপেপটাইড তৈরি করে যা হচ্ছে এমিনো এসিডের চেইন ছাড়া আর কিছুই না।

একটি পেপটাইডের ছবি এখানে দেখুন।

চারটি বিভিন্ন ধরনের এমিনো এসিড মিলে একটি পেপটাইড তৈরি করেছে। লক্ষ্য করলে দেখবেন যে এই চেইনের একপাশে একটি ফ্রি এমিনো গ্রুপ (বামপাশে) এবং আরেকপাশে একটি ফ্রি কার্বক্সিল গ্রুপ আছে। সেজেন্য যেকোন প্রোটিনের একপাশকে বলে এমিনো টার্মিনাস বা সাইট এবং আরেকপাশকে বলে কার্বক্সিল সাইট। এটা দিয়ে প্রোটিনটি কোন দিকে থেকে শুরু হয়ে (এমিনো টার্মিনাল) কোন দিকে শেষ (কার্বক্সি টার্মিনাল) হয়েছে বোঝা যায়।

 

 

দ্রষ্টব্যঃ ভিডিওটির আকার বেশ বড়। ডাউনলোডের সময় সেটা একটু বিবেচনায় রাখবেন। এই লেকচারে একটা এনিমেটেড মুভি ক্লিপের বাংলা অনুবাদ করে ব্যবহার করা হয়েছে। মূল মুভিটির স্বত্বাধিকার আমার নয়। এখান থেকে মূল ইংরজী ভার্সনটা দেখে নিতে পারবেন।

 

 

 

পরবর্তী লেকচারে থাকছে প্রোটিনের দ্বিতীয় মাত্রার গঠন নিয়ে আলোচনা।

 

Sorry, the file you have requested has been deleted.

Make sure that you have the correct URL and the owner of the file hasn't deleted it.

Get stuff done with Google Drive

Apps in Google Drive make it easy to create, store and share online documents, spreadsheets, presentations and more.

Learn more at drive.google.com/start/apps.

Comments

comments

About the author

খান ওসমান

আমি টরন্টো বিশ্ববিদ্যালয়ের মলিকিউলার জেনেটিক্স এর একজন পিএইচডি ছাত্র। কাজ করছি ম্যালেরিয়া জীবাণুর একধরনের প্রোটিন নিয়ে। আমার কাজ মূলতঃ এক্স-রে ক্রিস্টালোগ্রাফির মাধ্যমে প্রোটিনের গঠন নির্ণয়, এর সঙ্গে ম্যালেরিয়া রোগের সম্পর্ক নির্ধারণ এবং ঔষধ তৈরিতে সহায়তা করা ইত্যাদি বিষয়ের উপর। স্নাতক এবং মাস্টাসর্ ডিগ্রী অজর্ন করেছি চট্টগ্রাম বিশ্ববিদ্যালয় থেকে অনুজীববিজ্ঞান নিয়ে। আমার বতর্মান ল্যাব এর ওয়েবসাইটে ঢু মেরে দেখতে পারেন এখানে: www.thesgc.org.

5 pings

  1. প্রোটিনের গাঠনিক জীববিজ্ঞানঃ লেকচার ৩ক- গাঠনিক রসায়ন-দ্বিতীয় মাত্রার গঠন - শিক্ষক - বাংলা ভাষা

    […] ওসমানপিডিএফ ফরম্যাটে সেইভ করুন [ পূর্ববর্তী লেকচার | কোর্সের মূল পাতা | নিবন্ধনের […]

  2. প্রোটিনের গাঠনিক জীববিজ্ঞানঃ লেকচার ৩ক- গাঠনিক রসায়ন-দ্বিতীয় মাত্রার গঠন - শিক্ষক - বাংলা ভাষা

    […] ওসমানপিডিএফ ফরম্যাটে সেইভ করুন [ পূর্ববর্তী লেকচার | কোর্সের মূল পাতা | নিবন্ধনের […]

  3. প্রোটিনের গাঠনিক জীববিজ্ঞানঃ লেকচার ৩ক- গাঠনিক রসায়ন-দ্বিতীয় মাত্রার গঠন - শিক্ষক - বাংলা ভাষা

    […] ওসমানপিডিএফ ফরম্যাটে সেইভ করুন [ পূর্ববর্তী লেকচার | কোর্সের মূল পাতা | নিবন্ধনের […]

  4. প্রোটিনের গাঠনিক জীববিজ্ঞানঃ লেকচার ৩ক- গাঠনিক রসায়ন-দ্বিতীয় মাত্রার গঠন - শিক্ষক - বাংলা ভাষা

    […] ওসমানপিডিএফ ফরম্যাটে সেইভ করুন [ পূর্ববর্তী লেকচার | কোর্সের মূল পাতা | নিবন্ধনের […]

  5. প্রোটিনের গাঠনিক জীববিজ্ঞানঃ লেকচার ৩ক- গাঠনিক রসায়ন-দ্বিতীয় মাত্রার গঠন - শিক্ষক - বাংলা ভাষা

    […] ওসমানপিডিএফ ফরম্যাটে সেইভ করুন [ পূর্ববর্তী লেকচার | কোর্সের মূল পাতা | নিবন্ধনের […]